When: 2014-11-28

Collection location: Bolinas Ridge, Marin Co., California, USA [Click for map]

Who: Tom Bruns (pogon)

Specimen available

Notes:
On dead hardwood branch (maybe tanbark oak). Specimen was thin, tubes were shallow and rubbery. ID is based on ITS sequence:

TAACGAGTTCTTGAACGGGTTGTAGCTGGCTCTTTTTTTAGGAGCATGTGCACGCCTGGCTCAATTCCACTCCTTAACCTCTGTGCACTTATTGTAGGTCGGTGGAGGCTGGCGCAAGTCAGTTTGAAGCCTTCCTATGTTTTATTACAAACRTGTCAGTTATAGAATGTCTTACTTTGCTATAATGCAATTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCCTTGGTATTCCGAGGGGTATGCCTGTTTGAGTGTCATGGTATTCTCAACCCCCAAATTCTTTATTGAGTCTTGGTGGGCTTGGACTTGGAGGTTGTGCTGGATTTTTATTAATTCAGCTCCTCTGAAATACATTAGTGTGAATCTTACGGATCGCCTTCAGTGTGATAATTGTCTACGCTGTGGTTGTGAAGTATATTTGTA

Species Lists

Images

Proposed Names

83% (1)
Based on microscopic features: Monomitic, thick-walled, clamped hyphae, no cystidia, spores not found
Based on chemical features: ITS Sequence

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
Spores were tiny and allantoid
By: Tom Bruns (pogon)
2015-02-08 09:36:10 NZDT (+1300)

3.9-4.2 X 1.2