Observation 209527: Russula

Notes:
This Russula species is always very tiny and always on well decayed wood. The max cap size is about 1.5 cm.

Found in a forest of mixed Quercus and Oreomunnea mexicana about 2 km below El Zapotal.

Species Lists

Images

536998-2.jpg
DSC_3786.JPG
DSC_3791.JPG
DSC_3794.JPG
DSC_3796.JPG
DSC_3797.JPG

Proposed Names

87% (1)
Recognized by sight

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
GenBank MF067426
By: Alan Rockefeller (Alan Rockefeller)
2017-05-19 08:07:44 EDT (-0400)
ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2017-05-07 05:03:49 EDT (-0400)

GCCAGGGCTGTCGCTGATCTTCCAGGGTCGTGCACGCCCGGGTGCTCTCGCTCAATCCATCTCACCCCTTTGTGCATCACCGCGTGGGTCCCCCCTTTGCAGGGAGGGCTCGCGTTTTCACATAAAACTTGATACAGTCTAGAATGTTTATTTTTGCGGTTGCACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAACCCTCAAAACCCCTTTTTCTTTCACCGGAATGGGGGATTTTGGACTTGGAGGTTCGATGCTCGCTTTCGAAAGCAAAAGCGAGCTCCTCTTAAATGAATCAGTGGGGTCCGCTTTGCCGATCCTTGACGTGATAAGATGTTTCTACGTTTTGGATCTGGCACTGTTTTCTCTGCTTCTAACCGTCTCATCGACAAAAGATGGTGCTTCGGTCCCTGTCATCTACGTTGGCGGGAGGCTGGACCCACAAAGAAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAAGCATATCAATAAG