Notes:
Growing in mixed woods.
Caps up to 7.0 cm across and viscid.
Spores ~ 8.9-11.0 X 5.4-6.2 microns, ellipsoid to elongate(amygdaliform) and moderately rough.
Q(avg) = 1.65
KOH was neg. on all surfaces.

Images

Proposed Names

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
Sequenced
By: Dimitar Bojantchev (dimitar)
2019-05-11 22:05:07 PDT (-0700)

Here is the sequence — same as A.H. Smith collection of “aggregatus” from MICH:10311

>MO218149
AAGGATCATTATTGAAATAAACCTGATGAGTTGCTGCTGGCTCTCTTGGGAGTATGTGCACACTTGTCATCTTTATATCTCCACCTGTGCACCCTTTGTAGACTTGGATATCTTTCTGAGTGCTTTAGCACTTCAGGTTTGAGGATTGACTTTACTGTTCTTTCTTTATATTTCCAGGTCTATGTTTCTTCATATACCCCATTGTATGTTATAGAATGTAGTAAATAGGTCTTTGTGCCTATAAATCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGTTAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAATATATCAACCTCTTCAACTTTTGTTGAGTGTTGGATGTGGGGGTTTTTTTGGTGGCTTCCTTCCGAAGGCCACTCCCCTGGAATACCTTAACGGAACCATTTGGGGAATCCTTCCATGGTGGGAAAATTAACCATGCCAATGGCCTGAAACAAGGTCCACTTAATACCATCCATTTACTTGGAACAAATTTTAATAATGGGACCTCCAATCCAGGAAGAATAACCCCTTAACTTAAACCTAATCATAAAACCGGAAGGAAAA