Notes:
This observation is for the Amanita. It was found next to the Chalciporus and across the road from the Boletus.

Species Lists

Images

DSC_1860.JPG
DSC_1863.JPG

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2015-12-22 07:18:38 CST (-0600)

The only exact match in GenBank for this sequence is a collection from Cochise Co., Arizona.

CAGGGGGGAGGTGGTTGTAGCTGGCCCTTAGGGGCATGTGCACACTGTGTCTCTCTTGCTTGTTTCTTCATTCTCTCCACTTGTGCACTGCTTGTAGGCAGCCTTGGCATTGTTCAGGTTGTCTATGATTTTCTTTACATACATGAACACTTGTTGTACAGAATGTGATAAAAAATAGTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCTCAAAGCATACACTTGAGTGTGTGTTTTGGATTGTGGGAGTGTCTGC

Created: 2015-12-17 03:05:52 CST (-0600)
Last modified: 2018-02-17 22:42:12 CST (-0600)
Viewed: 128 times, last viewed: 2019-03-18 11:16:48 CDT (-0500)
Show Log