Notes:
This observation is for the Amanita. It was found next to the Chalciporus and across the road from the Boletus.

Species Lists

Images

DSC_1860.JPG
DSC_1863.JPG

Proposed Names

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2015-12-22 03:18:38 HST (-1000)

The only exact match in GenBank for this sequence is a collection from Cochise Co., Arizona.

CAGGGGGGAGGTGGTTGTAGCTGGCCCTTAGGGGCATGTGCACACTGTGTCTCTCTTGCTTGTTTCTTCATTCTCTCCACTTGTGCACTGCTTGTAGGCAGCCTTGGCATTGTTCAGGTTGTCTATGATTTTCTTTACATACATGAACACTTGTTGTACAGAATGTGATAAAAAATAGTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCTCAAAGCATACACTTGAGTGTGTGTTTTGGATTGTGGGAGTGTCTGC