Species Lists

Images

DSC_1860.JPG
DSC_1768.JPG
habitat
DSC_1863.JPG

Proposed Names

29% (1)
Recognized by sight
58% (1)
Recognized by sight: Closest ITS DNA match (7 base pairs away)

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-04-15 03:47:42 PDT (-0700)

GCGTGGAGGGGGGGAGACGAGCGGACGAAGTTTGGTGGAGGTTGTCGCTGGCCTTCGG
GCATGTCGCACGCCTCTGTCTTAGTCTCCGTTCCCTTTCTTCTTTTGCGTGGACTCGTTCTCTCAAACACCTGTGCACCC
GTTGTAGGCTTCCTCGCGAGGGGAGACCTATGTCTTTTCATAAACTCGTATGTATACAGAATGTCTACGTTTCAACGTCG
TCCGGCTCGGGCGATGGCGAATCGAAATCATAAACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACG
CAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGT
ATTCCGAGGAGCATGCCTGTTTGAGTGTCATCGAATTCTCAACCATGTCTCGATTGATTTCGAGCGCATGGCTTGGAAGT
GGGGGCTGCTGGCGGCGCGAGCTGTCGGCTCTCCTGAAATGCATTAGCAGAGGTGAGCCTTTCGTGCACGGCCTTCGACG
TGATAATGATCGTCGTGGCTGGAGCGAGGGGCATGAATCGTCGCTGCTTCTAGTCTGATCCTTGCGATCGCTTTTGAAAC
TTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCA