Notes:
Under douglas fir, white fir and incense cedar.

Images

csquamosa-processed.JPG
csquamosa-natural.jpg
csquamosa-offcameraflash.jpg
csquamosa-oncameraflash.jpg
csuqamosa.rosecomb1.JPG
csuqamosa.rosecomb2.JPG
csuqamosa-withrose.JPG

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
LSU sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-05-27 17:14:28 CDT (-0500)

GAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCTTCAGTTTGTTTTACCAATTTGAATTGGCTTGGATAATGGGAGTTGCGGGCTTCTCAGCAAGTCGGCTCTTCTTAAATGTATTAGTGGAACTTTTGTTGTGAACCCATCATTGGTGTGATAATTATCTACGCCCATCTGATGTTGA