Notes:
Near incense cedar – a root that was growing to the morel went directly to an incense cedar tree. Also not far from white fir.

Several found in a 5 foot area.

Species Lists

Images

DSC_9049.JPG
DSC_8989.JPG
DSC_8991.JPG

Proposed Names

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-04-14 23:33:40 PDT (-0700)

GGAGGCAAGGGGCCGACAGGATTAGTAGCTTTTACGTTGTTGAACGTCCTGGCCGGACC
CGGAGCCGCCCCCATCTAAACCCTCTGCGTACCTGTCCCTTCTTGCTTCCCCCGACATCTCGTCGGGGGGAGGGAACAAC
CAAAACTCTTTGTGAATCAAACAGCCGTCAGAATTATAAAACAAACAAAAAGTTAAAACTTTCAACAACGGATCTCTTGG
TTCCCACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAA
CGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATAAAAACCTCCTCCCCCTTCGGGTTTTGTT
ACTATCGTTGGGGGGTTTTGGCCTAATGGGATAGCGATTGGCAATTCGTTTCCCAATGTCCTAAATAAACGTAGACCCGC
CTCCAGATGCGACAGCACCGAGGCCATCAACCGTGGAGTTATGGGATATATAGGCTTGCAGTAAAATGCTCACCTCTCTT
CACACGCCGATGGCACGACAGTTGCAGTTGCGGGCGTAAATTGGAGCCCTTTTCAGGACCCTCGTGGCCTAGCATCCACA
ATACATAATTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCAT