Observation 236456: Morchella brunnea M.Kuo

Notes:
I originally collected this for the table, but then when I noticed that there were no white firs around I decided to save it for science. Under incense cedar and jeffrey pine, no white fir in sight. Most of the morels I found that day were under mixed woods with lots of white fir around.

Species Lists

Images

610881.jpg
DSC_9051.JPG
DSC_9052.JPG
DSC_9058.JPG
Edited to remove my thumb

Proposed Names

92% (2)
Recognized by sight: 100% ITS DNA match

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-04-15 14:46:48 CDT (-0400)

GGGAGGCATTAGGGGACCGACCAGGGCTAGTAGCTTTACGTTGTTGAACGTCCAGTATG
GACCCGAAGCCTCCCCCATCTAAACCCTCTGCGTACCTGTCCCTTCTTGCTTCCCCCGGCATCTCGTCGGGGGGAGGTAA
CAACCAAAACTCTCTGTGAATCAAACAGCCGTCAGAATTATAAAACAAACAAAAAGTTAAAACTTTCAACAACGGATCTC
TTGGTTCCCACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTT
TGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATAAAAACCTCCTCCCCCTTCGGGTTT
TGTTACTATCGTTGGGGGGTTTTGGCCTAATGGGATAGCGATTGGCAATTCGTTTCCCAATGTCCTAAATAGACGTAGAC
CCGCCTCCAGATGCGACAGCACCGAGGCCATCAACCGTGGAGTTATGGGATATAATAGGCTTGCAGTAAAATGCTCACCT
CTCTCCACACGCCGATGGCACGACAGTTGCAGTTGCGGGCGTAAATTGGAGCCCTTTTCAGGACCCTCGTGGCCTAGCAT
CCACCATACATAATTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGGCGGAGGAA