Please do not re-click a link while waiting for a page to load. (It’s slower and degrades site speed for all users.)
To get images for machine learning, see MO Images for Machine Learning

 

Notes:
Growing on horse manure. Edward Barge (landsnorkler) collection from https://www.shroomery.org/...

Species Lists

Images

pcap4.jpg
Copyright © 2010 Edward Barge (landsnorkler)
pcop1.jpg
Copyright © 2010 Edward Barge (landsnorkler)
pcap2.jpg
Copyright © 2010 Edward Barge (landsnorkler)
pcap3.jpg
Copyright © 2010 Edward Barge (landsnorkler)

Proposed Names

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-04-15 16:19:26 CDT (-0400)

ATGGTGTTGGTTGTTGCTGGCTTCTAGGAGCATGTGCACGCCCGCCATTCTTATCTTTCCACCTGTG
CACACTATGTAGGTCTGGATAACTCTCGCTCTCGGGCGGATGCAGGGATTGTCGCTTGCGACTCTCCTTGAATTTCCAGG
TCTATGTATTTACATACCCCAATTGAATGATGAAGAATGTAGTCAATGGGCTTTTAGCCTATAAAACAATATACAACTTT
CAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTG
AATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAA
CTTTAACATTTTTGTTAAAGCTTGGATGTGGGGGTTGTGCAGAACGCTTCGGTGGTCTGCTCCCCTTAAATGTATTAGCG
AGTTCAAACTGAGCTCCGTCTATTGGTGTGATAATTATCTACGCCGTGGATTGGACTTAGACTTGCTTCTAACCGTCCGC
AAGGACAACTCTTGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAG