Notes:
Specimens were fairly dry and had fruited prior to last rain (5/8/16) based on the debris dammed by them. Copious dense white mycelium at the base of the stem. Soil temps 45 degrees.

Species Lists

Images

Proposed Names

92% (2)
Recognized by sight: deep sinus between cap and stem, granulated stem with holes/folds from base to apex (lacunose), on ground under douglas fir (Pseudotsuga menziesii) at 8000-8500’ in non-burned area

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
Thanks Judi!
By: Terri Clements/Donna Fulton (pinonbistro)
2017-11-12 12:40:05 PST (-0800)
Fabulous Ob in every aspect, Terri!
By: Judi T. (AvidAmateur)
2017-11-12 11:56:10 PST (-0800)
Specimen accessioned to Gilbertson Herbarium, U of A, Tucson, Az
By: Terri Clements/Donna Fulton (pinonbistro)
2017-02-17 16:12:15 PST (-0800)
M. snyderi confirmed by Dr. Kerry O’Donnell
By: Terri Clements/Donna Fulton (pinonbistro)
2017-02-17 15:52:57 PST (-0800)

ITS:

GGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCAAGAACCACACAGAAAAAGGGAGGCAAAGGGGCCGACAGGATTAGTAGCTTTTACGTTGTTGAACGTCCTGGCCGGACCCGGAGCCGCCCCCATCTAAACCCTCTGCGTACCTGTCCCTTCTTGCTTCCCCCGACATCTCGTCGGGGGGAGGGAACAACCAAAACTCTTTGTGAATCAAACAGCCGTCAGAATTATAAAACAAACAAAAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCCACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATAAAAACCTCCTCCCCCTTCGGGTTTTGTTACTATCGTTGGGGGGTTTTGGCCTAATGGGATAGCGATTGGCAATTCGTTTCCCAATGTCCTAAATAAACGTAGACCCGCCTCCAGATGCGACAGCACCGAGGCCATCAACCGTGGAGTTATGGGATATATAGGCTTGCAGTAAAATGCTCACCTCTCTTCACACGCCGATGGCACGACAGTTGCAGTTGCGGGCGTAAATTGGAGCCCTTTTCAGGACCCTCGTGGCCTAGCATCCACAATACAT

M. snyderi confirmed by DNA analysis. Terri
By: Terri Clements/Donna Fulton (pinonbistro)
2016-06-15 15:01:37 PDT (-0700)
Will be sent off for DNA sequencing with other samples from recent AMS forays.
By: Terri Clements/Donna Fulton (pinonbistro)
2016-05-26 07:37:13 PDT (-0700)