Please do not re-click a link while waiting for a page to load. (It’s slower and degrades site speed for all users.)
To get images for machine learning, see MO Images for Machine Learning

 

Notes:
Specimens were fairly dry and had fruited prior to last rain (5/8/16) based on the debris dammed by them. Copious dense white mycelium at the base of the stem. Soil temps 45 degrees.

Species Lists

Images

Proposed Names

92% (2)
Recognized by sight: deep sinus between cap and stem, granulated stem with holes/folds from base to apex (lacunose), on ground under douglas fir (Pseudotsuga menziesii) at 8000-8500’ in non-burned area

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
Thanks Judi!
By: Terri Clements/Donna Fulton (pinonbistro)
2017-11-12 15:40:05 CST (-0500)
Fabulous Ob in every aspect, Terri!
By: Judi T. (AvidAmateur)
2017-11-12 14:56:10 CST (-0500)
Specimen accessioned to Gilbertson Herbarium, U of A, Tucson, Az
By: Terri Clements/Donna Fulton (pinonbistro)
2017-02-17 19:12:15 CST (-0500)
M. snyderi confirmed by Dr. Kerry O’Donnell
By: Terri Clements/Donna Fulton (pinonbistro)
2017-02-17 18:52:57 CST (-0500)

ITS:

GGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCAAGAACCACACAGAAAAAGGGAGGCAAAGGGGCCGACAGGATTAGTAGCTTTTACGTTGTTGAACGTCCTGGCCGGACCCGGAGCCGCCCCCATCTAAACCCTCTGCGTACCTGTCCCTTCTTGCTTCCCCCGACATCTCGTCGGGGGGAGGGAACAACCAAAACTCTTTGTGAATCAAACAGCCGTCAGAATTATAAAACAAACAAAAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCCACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATAAAAACCTCCTCCCCCTTCGGGTTTTGTTACTATCGTTGGGGGGTTTTGGCCTAATGGGATAGCGATTGGCAATTCGTTTCCCAATGTCCTAAATAAACGTAGACCCGCCTCCAGATGCGACAGCACCGAGGCCATCAACCGTGGAGTTATGGGATATATAGGCTTGCAGTAAAATGCTCACCTCTCTTCACACGCCGATGGCACGACAGTTGCAGTTGCGGGCGTAAATTGGAGCCCTTTTCAGGACCCTCGTGGCCTAGCATCCACAATACAT

M. snyderi confirmed by DNA analysis. Terri
By: Terri Clements/Donna Fulton (pinonbistro)
2016-06-15 18:01:37 CDT (-0400)
Will be sent off for DNA sequencing with other samples from recent AMS forays.
By: Terri Clements/Donna Fulton (pinonbistro)
2016-05-26 10:37:13 CDT (-0400)