Notes:
Found in burned out stump depression that based upon needles I think was a fir tree. Location was in the middle of a fire – hot area as everything was scorched, no needles etc on the surrounding area

I gave a portion of the collection to Alan Rockefeller for sequencing and he recovered a really strong read back from it for ITS:

GGCAGCCGAGGGGCCACCAGGGCTAGTAGCTTTACGTTGTTGAACGTCCTGGCCGGACCCGGAGCCGCCCCCATCTAAACCCTCTGCGTACCTGTCCCGCCTTGCTTCCCCTGGCTACCAGCTGGGGGGAGGAACAACAACCAAAACTCTTTGTGAACAAACCGACGTCAGAATCATAACAAAACAAAAAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCCACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATAAAAACCTCCTCCCCCTTCGGGTTTGATTACTATCGTTGGGGGGTTTTGGCCTAATGGGATAGCGATTGGCAATTAGTTTCCCAATGTCCTAAATAGACGTAGACCCGCCTCCAGATGCGACAGCACCGAGGCCATCAACCGTGGAGTTATGGGATATATAGGCTTGCAGTAAAATGCTCACCTTTCTCCATACGCCGATGGCACACCGGTCGCAGTTGCGGGCGTAAATTGGAGCCCTTTTCAGGACCCTCGTGGCCTAGCATCCACCATACACAATTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGG

Alan notes that it 100% hits this other Morchella from the Lake County fire:
http://mushroomobserver.org/237290

Original observation was in iNaturalist because of ease upload:
http://www.inaturalist.org/observations/3027504

Species Lists

Images

morel1.jpg
morel6.jpg
morel5.jpg
morel4.jpg
morel3.jpg
morel2.jpg

Proposed Names

54% (1)
Recognized by sight
92% (2)
Based on chemical features: 100% ITS match with KM204675

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
GenBank MF073270
By: Alan Rockefeller (Alan Rockefeller)
2017-05-19 08:08:45 CDT (-0400)