Please do not re-click a link while waiting for a page to load. (It’s slower and degrades site speed for all users.)
To get images for machine learning, see MO Images for Machine Learning

 

Notes:
Found in mixed conifer woods.

Ex situ.

Species Lists

Images

Proposed Names

57% (1)
Recognized by sight
28% (1)
Based on chemical features: 631/647(98%) match with http://www.ncbi.nlm.nih.gov/nucleotide/596108284, a sequence from Russia

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-06-24 21:08:48 BST (+0100)

AGGTTGTTGCTGGCTCTTAGGGGCATGTGCACGCCTATTCCATTTTATTAACCACCTGTGCACTCTATGTAGATCTGAAACACTTTCGAGTACAACTCGGTCAAAGGAATTGCTGTGTATAATGCCGGCTTTTCCTTATTCTATTTCAGGTCTATATTTCTATATACTCCATATAAAGTTTGAGATTGTAATTGTTAGGCATATTGTGCCTTATAAATAATTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCGTGAAATTCTCAACCTTTCAAGCTTTGATTAAGAAGCTTTTGAAGGGCTTGGATTTGGGAGTTTGCTGGTTCTAGCGATTCAGCTCTCCTTAAATATATTAGCAAGATAATCGCTGAATCATCTTTGATATGATAATTATCTATATCATCGATGAAACAGTGCCTTTCCTTCAGGGAAGGATCTGGCTTCTAAGAGTCTCTCGAGACAATTGTTTGACACATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATA