Please do not re-click a link while waiting for a page to load. (It’s slower and degrades site speed for all users.)
To get images for machine learning, see MO Images for Machine Learning

 

Notes:
collected by others at the OMS morel foray. did not fit neatly into any of our published morel species. It is commonly seen in this area.

Species Lists

Images

DSCN1303.JPG
several days after collection and storage. It was quite blonde when fresh.

Proposed Names

57% (1)
Recognized by sight: blonde when fresh; a member of the esculenta clade
86% (1)
Recognized by sight: macro-morph of a blonde morel, but black morel DNA.
Based on chemical features: 100% match to tridentina/frustrata.

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
DNA results from Alan Rockefeller:
By: Debbie Viess (amanitarita)
2016-06-10 19:10:41 EDT (-0400)

CATGAGCGAGGGATCGCGCTCGCGCTGGGCTCGATAGACGCGCTAGCACCCGTCAGGCCCGGAGGGCGAACCAGGCCCCTGGGGCCGGCAGGTTAAACCCAAGGTACCCATCCAAGGTGGACAGTCCTCCCAGAGTTCGCCCTTCGGCGTCTGCGAGCCATCGGGGCATGGAACCTTGGGGGCTGTCGGTTTCCCGCTGGGCATACGTCCGATGCCGCCTCGGGGAGCGAAACGTGGCTCGCGCAGCGTCGCAGCGTTGGTCCCCCACTCACTCACCAAAACCCTCTGCGTACCTTGCCCACTTGCTTCCCCCGGCCCTCCCGGCCGGGGGGCGACACCAAAAACCAAACTCTTTGCGATGAACCGACGTCTGAATGCCAAAAGCAAAACAAAAACAGTTAAAACTTTCAACAACGGATCTCTTGGCTCCCACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATAAAACCCCCTCCCCCTCGGATTAAATGTTCCTTGGGGGGTATTGGCCAATGGGATTGCGAGATAGCAATTGTTACCCAGGCGCCCAAATGCATCAGTACCCCGCCATTTACAGATTTACCAGCACCGAGGCCGTCAACCGTGGAGTTATGGGAATTATAGGCTTGCAGTAATATGCTCACCTCTCTCCATACGCAGGCGGCACACCGGGTAGAGTCGCGGGCGTAAAGCGGAATCCGAAACGGCCCTCACGGGTAGAGGAGGATCCTTGCGGGCTAGTCACCCCTCATCACAATTTGACCTCGGATCAGTAGGGATACCCGCTGAACTTTAAGCATATCA