Species Lists

External Links

Images

Proposed Names

29% (1)
Recognized by sight: gregarious, appearing terrestrial, long rooting stems, under fir, spruce and pine, reminds me of Phaeocollybia but white spored, a rooting Rhodocollybia or Gymnopus perhaps?
53% (1)
Recognized by sight: Serrated white gills, a couple of species are known to have radicating stipes.
-57% (1)
Recognized by sight: red brown hygrophanous caps, white serrated gills, rusty brown radicating stem, on conifer debris
77% (2)
Used references: Results of sequencing—701 of 702 match to AY313292 (mismatch due to 1 gap.) See also DQ444317: 694 of 696 due two N’s (ambiguous) in DQ444317.

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
Did not scope it
By: Terri Clements/Donna Fulton (pinonbistro)
2017-04-01 22:02:30 CDT (-0400)

and not many submissions of R. badiialba on GenBank but no significant similarity (431 of 493) between this obs and EU486446. Regarding the two submissions which are a close match I guess it is possible that neither is R. butyracea but the authors on AY313292 are Mata,J.L., Halling,R.E., Hughes,K.W. and Petersen,R.H. and the authors on DQ444317 are Mata,J.-L., Hughes,K.W. and Petersen,R.H.

Badiialba is in AZ?
By: Pgrunow
2017-04-01 21:16:11 CDT (-0400)
Did you scope this?
By: Noah Siegel (Noah)
2017-04-01 20:45:06 CDT (-0400)

It looks more like Rhodocollybia badiialba, than butyracea.

ITS as submitted to GenBank
By: Terri Clements/Donna Fulton (pinonbistro)
2017-03-28 01:42:11 CDT (-0400)

ATAGTCAATAAATTGTCTGAAACAACAGACAGTTAGAAAGCAGATACATTTCCCACATTCAGATAAAGCAACTTAATGCGATATCACAACCAGGATCTAGCCTAAGCACACCTGACAGTTGAACCAAGCAAAGCGTAGATAATTATCACACCAAGATGGACCAACCAAACGGGAATTCCACTAATGCATTTAAGAGGAGCTGAACATCTAAGACGCCAACAAGCCTCCACATCCAAGCTTCAATAAGTTAATAAAAACTTTTGAAGTTGAGAATTTAATGACACTCAAACAGGCATGCCCTCCGGAATACCAGAGGGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGGGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATAAAGTTTAGAGGGTCAATGAAGTCCCAGTAAAACGACATTCTAGACATACTTCAATGGTTTGTAAAGACATAGAAGTCCTATTATGCTAACTAACAAGTCTTTCGACTTGAGAGCCAACCTAATAACAACTCCTACAATAAGTGCACAGGTGGATGGATAAGAAACGGTTATCACCAAGTTAGAGCTGTGCACATACTTCAAAAGCCAGCACTAGAACTAACAGGGCGCCGTTACATCTCAATAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTT