Notes:
Cultured from graphene. The Sporidiobolus salmonicolor is not visible in the photo, but its DNA was in the cluster on the right.

Species Lists

Images

DSC_3478.JPG

Proposed Names

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
ITS Sequence
By: Alan Rockefeller (Alan Rockefeller)
2017-02-22 00:56:01 CST (-0500)

TGTCCATTTACTTGGAGCCCAACCTTCTCACTTTCTAACCCTGTGCATCTGTATCTAACGGTGAGCTGCC
TTCGGGTGGCGAGCCTTCACTTTAAAACACCAAGTCTATGAATGTATATAATCATAACTATATAAAAACT
TTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTG
CAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCACTCTCTGGTATTCCGGAGAGTATGTCTGT
TGGAGTGTCATGAATTCTTCAACCCCACCGTTTCTTGCAAACGCGTGGGTGCTTGGATTCTGAGCGCTGC
TGGCTTCGGCCTAGCTCGTTCGTAATGCATTAGCATCCCGATGACAAGTTTGGATTGACTTGGCGTAATA
GACTATTCGCTGAGGAGTAAGTGGCCTTCGGGTTACTGAGCCAACTCGTTTCAGGAAGCTTCTAATCCCT
AAAGTCTACCTTTTAGATTAGATCTCCAATCAGGCAGGATTACCCGCTGAACTTAAGCATATCAATAAGC
GGAGGAA