Notes:
Under Monterey cypress. Staining dark maroon in 5% KOH.

Species Lists

Images

DSC_3772-2.jpg
DSC_3773-2.jpg
DSC_3774-2.jpg
DSC_4162-3.jpg
Gill edge 100x in KOH
DSC_4163-2.jpg
Gill edge 400x in KOH
DSC_4165-2.jpg
Gill edge 400x in KOH
DSC_4164-3.jpg
Gill edge 400x in KOH

Proposed Names

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
GenBank MF144428
By: Alan Rockefeller (Alan Rockefeller)
2017-06-06 22:37:08 PDT (-0700)
ITS sequence a 100% match with the holotype
By: Alan Rockefeller (Alan Rockefeller)
2017-05-17 01:11:28 PDT (-0700)

ITS sequence a 100% match with the holotype JF898319

GCTGGTCCTTTAAAAACAGACAAGTGCACGCTTGACTCAATTTTATAAACCACTTGTGAACCATTTGTAGACTTGGATAACAATCGATTTTAATCGGATAGAAAGATTGCGCATTAGCTTTCTTTCAATTTCCAAGTCTATGTCTTTATATACTTGATTTAATGAATGTCAGTTGGCCTATCATAATTATAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATGAATTTATCAAACCACTTCAATTTTGTATTGAAATGGTCTTGGACTTGGGATTTGCTGGTAATTTTCATTATCAGCTATTCTTAAATGCATTAGTGGAATTGACAAAGTTTGCACTGACGTGATAATTATCTACGCCATTCTTACTTTACAAGTCTGCTTCTAACTTGAATTGACAATTTTGGGAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA