Notes:
Apologies for the awful photo. I wasn’t particularly focused on this collection and didn’t capture it well. Per: Joe and Kare, this matches the type for C.substriatus. The type location is Lake Cushman, WA and this was collected on Vancouver Island. It was noticeably viscid capped in wet conditions and was growing in young mixed conifer forest in moss. My first thought was C.subpurpureus (Smith) but collections matching this description need further research as there is some confusion with the type collection. I hope to collect more examples and better photographs this coming fall.

Per: Ammirati / Liimatainen Sequence matches Cortinarius substriatus (Kauffman, 1915)

SEQUENCE:
TCTACTGATTTGAGGTCACATAAATGATAAGTTGTCCAAGGACTGTTAGAAAGCTGAACCATCCCTCACATTCAATAGCGTAGATAGT
TATCACGCCAATGAACAGGGTTGTTCTGCTAATGCATTTCAGAGGAGCTGAACTCATTTAAGAGGCCAGCAAACCCCCACATCCAAAC
CACTCAGAAATGAGAAGGTTGATATATATTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAA
GATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTT
GCTGAAAGTTGTATAGATTTTATAGGCACAACATTCTATTAACATACATTGGGGTAAATGAAAAAGCAACATAGACCTGGAAGGCCTA
CAAAAGGTGCACAGGTGGAGATATAAAGATGACAAGGCGTGCACATGCTCCCTAGAGAACCAGCAACAACCCATCAGGTTTATTTCAA
TAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTACTTCC

Species Lists

Images

Proposed Names

79% (1)
Used references: Joe Ammirati and Kare Limatainen

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
Description: Kauffman
By: Shannon Adams (Sulcatus)
2017-05-01 15:27:08 EDT (-0400)

“Cortinairus substriatus, C.H Kauffman. North American Flora Vols 10-11. Item 61. P.307

Pileus subfleshy, broadly conic-campanulate, 3-7cm broad; surface viscid, glabrous, at first Natal-brown becoming Mikado-brown with a slight purplish tint, fading, striate at times on the thin margin; lamellae adnate, rounded behind, moderately broad, ventricose, close to crowded, not reaching the margin of pileus, at first tinged violaceious-purplish, at length cinnamon, stipe elongate, tapering from the base to the apex, 8-12cm long, 6-8mm thick above, twice as thick at base, dry, stuffed, at first clothed by a very thin, white, evanescent sheath, then subfibrillose, at first distinctly violaceous purple at the apex, soon fading to pallid, rather slender, spores narrowly ellipsoid, smooth, 9-10×5-6 microns, pale ochraceous under microscope. Collected on moss, under Douglas Fir and hemlock and Lake Cushman on the Olympic Mountains, WA, October 20, 1915. herbarium: U.Mich.

Created: 2017-05-01 15:11:23 EDT (-0400)
Last modified: 2017-05-01 15:25:53 EDT (-0400)
Viewed: 46 times, last viewed: 2019-08-18 01:22:06 EDT (-0400)
Show Log