Notes:
Xoe Riphenburg collection. Found in soil near the Claremont DMV.

ITS sequence: TGATGGGTTGTAGCTGGCTCTTCGGGGCATGTGCACGCCTGTCTTGATTCTATTCATCCACCTGTGCACC
TTTTGTAGTCTTGGGGTTGAAAAGCGGTCAAATATCGGACGGTTATTGTGGCTGTTCCGGATGTGAGGAT
TGCTGAGTGCGAAAGCATACAGCTTTTCTCAATGTGACTTGTAAACTCTCCCTCGAGCACTATGTTTTCA
TATACCACATAGTATGTTGTAGAATGTGATCAATGGGCCTATGTGCCTATAATAATCATATACAACTTTC
AGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAG
AATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTG
AGTGTCATTAAATTCTCAACCCCTCCAGCTTTTGTGAGTTGCGATGGGGCTTGGAAGTTGGGAGTTTGCG
GGCCTTTGTA

Species Lists

Images

15147095373031325184081.jpg

Proposed Names

58% (1)
Based on chemical features: 99% ITS match with EU833653

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
GenBank MF073285
By: Alan Rockefeller (Alan Rockefeller)
2017-05-19 12:12:33 UTC (+0000)

Created: 2017-05-10 05:12:18 UTC (+0000)
Last modified: 2018-02-05 11:41:58 UTC (+0000)
Viewed: 80 times, last viewed: 2019-04-30 00:25:54 UTC (+0000)
Show Log