Observation 276166: Thyronectria Sacc.

Notes:
Cultured from Morchella brunnea, http://mushroomobserver.org/274561.

Forming orange fruit bodies on agar.

ITS sequence:

AGCCCCGGCGCCTCTGTGCCCGGAATCAGGCGCCCGCCGGAGGCCCCAAACTCTTGTTTTTTAGTGATATCTTCTGAGTCTCACAAACAAATAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCTAGTACTCTAGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCCCGGGCTTGGTGTTGGGGATCGGCCGCCGTTAAACCGGTGGCCGGCCCCGAATTATAGTGGCGGTCTCGCTGTAGCCTCCTCTGCGTAGTAGCACACCTCGCACCGGAACGCAGCCTGGCCACGCCGTAAAACCCCAACTTCTGAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA

Species Lists

Images

DSC_7586-2.jpg
06.20.2017
DSC_6987-2.jpg
DSC_6991-2.jpg
DSC_6992-3.jpg
DSC_6992-2.jpg
DSC_7589-2.jpg
400x in KOH
DSC_7587-2.jpg
400x in KOH
DSC_7588-2.jpg
400x in KOH

Proposed Names

58% (1)
Based on chemical features: 99% ITS match with KT423109
84% (1)
Recognized by sight: Synonymous

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
GenBank MF085559
By: Alan Rockefeller (Alan Rockefeller)
2017-05-19 04:46:13 PDT (-0700)

Created: 2017-05-10 01:39:47 PDT (-0700)
Last modified: 2018-11-12 12:20:45 PST (-0800)
Viewed: 87 times, last viewed: 2019-08-12 12:33:22 PDT (-0700)
Show Log