Notes:
Observation was at Oregon Mycological Society spring MycoCamp at Suttle Lake, OR.
Collection by Leah Bendlin at Lost Lake just off Hwy.22 near Santiam Pass. Elevation was about 4100 ft. with mixed high elevation conifers with lots of snow still present.

Spore info: white, elliptic, 7-9 × 5.5-6, Av. 8 x6, ornamentation (warts?) less than .5u and fairly evenly distributed across the face of the spore, perhaps 20 – 25 across visible surface, measurements taken in Melzers, spores appeared Gray (not blue) under the scope, warts were near black, Melzers on spore deposit near black, some ornamentation could be observed in water but Melzers enhanced visibility to a large degree.

No cystidia observed

Pileipellis appears to be a single layer of interwoven hyphae, mostly 5-7u wide but a few as small as 2u.

Species Lists

Images

Proposed Names

67% (3)
Used references: MatchMaker Mushrooms
Based on microscopic features: Spores were amyloid and ornamented
-62% (2)
Recognized by sight: Melanoleuca spores have amyloid warts, not amyloid everything
12% (2)
Recognized by sight
89% (2)
Used references: DNA match to TYPE

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
Here’s the real sequence
By: Danny Miller (alpental)
2019-06-02 03:41:42 AEST (+1000)

I did not use KOH. What does that mean? Does that show you something interesting?

The sequence added was a typo, only a part of it was copied. Here’s the real sequence:

CATTAATGAATAAACTCGGTGGGTTGTTGCTGGCTCCTTGGAGCATGTGCACATCTGCCATTGTTTCATTCTTTCTCCACCTGTGCACCTTTTGTAGGCTTGGATATCTCTCAAGGAATATACATTCCTTGGATTTAAGGATTGGTTGGTTTAACAACCTTTCCTTTGCATTTCCAGTCTATGTTTTATATATTTACACCCCATTTGTATGTTTTAGAATGTTTATATTTGGCCAAATAGGCTTTAAAACTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAATCCTCTCTTGGTTTATTCTCAGTTGGGCTTGGATTATGGGGGTTTTTGCCGGCTTTGCAAAAAGTCAGCTCCCCTTAAAAATATTAGCAAGACTCTTGTTGCAACCTTCTATCTGGTGTGATAATTATCTACATCATAGGTTATGTGCATGTCTGGCTTCTAACAGTCCATTAACTTGGACAAAACTTTGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTCTGGCTGTCCGAGT

This may match the type but…
By: Alan Rockefeller (Alan Rockefeller)
2019-06-01 10:30:31 AEST (+1000)

The sequence added to this observation has no overlap with the type sequence posted in the comments, so there is no way to compare the two. There must either be more sequences of the type or more sequences of this observation. Or perhaps the sequence of this observation is longer and only one fragment or read was posted.

BLASTing the two sequences gives similar results so it seems very likely that this matches the type, but the data isn’t here.

KOH
By: Alan Rockefeller (Alan Rockefeller)
2019-06-01 10:20:04 AEST (+1000)

Did you apply KOH before you put the Melzer’s?

thanks for these updates too!
By: else
2019-05-23 10:43:15 AEST (+1000)

good to see that it really fits within Melanoleuca, despite the absence of cystidia.
but, yes, Melanoleuca is a mess. we can start getting an idea about the species in the western USA but naming them with confidence is another issue. Only the names of species described from here can be reliably used.

M. angelesiana
By: Danny Miller (alpental)
2019-05-23 03:01:38 AEST (+1000)

Both Vizzini’s paper, and a 2018 paper by Kalmer about the first supposed record of M. angelesiana in Turkey used sequences labelled M. angelesiana that were not closely related to the type, as it turns out. Sorry, Turkey.

Melanoleuca angelesiana
By: Danny Miller (alpental)
2019-05-23 02:59:14 AEST (+1000)

Vizzini has a good Mycotaxon 2012 paper on Melanoleuca. Many of the IDs may be wrong in the paper, but it shows an overview of the genus.

Some Melanoleuca, like angelesiana, lack the characteristic “stinging cystidia” found in many others, but it turns out there is more than one clade that lacks them, so the phylogeny is complicated. M. eccentrica’s WA type was also sequenced, lacking cystidia as well, but it’s not in the same clade, it appears to be closer to M. brevipes, with smaller cystidia, and similar DNA is also found in Pakistan.

Unfortunately, the genus is so poorly studied, there’s not even agreement on which subgenus M. melaleuca is in, the most famous species.

The type sequence is coming to Genbank but not there yet, here it is:

>Melanoleuca angelesiana TYPE WA
CTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAATCCTCTCTGGGTTTATTCTCAGTTGGGCTTGGATTATGGGGGTTTTTGCCGGCTTTGCAAAAAGTCAGCTCCCCTTAAAAATATTAGCAAGACTCTTGTTGCAACCTTCTATCTGGTGTGATAATTATCTACATCATAGGTTATGTGCATGTCTGGCTTCTAACAGTCCATTAACTTGGACAAAACTTTGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTCTGGCTGTCCGAGTGTATCTA

thanks for the updates !
By: else
2019-05-23 02:33:19 AEST (+1000)

but i do have a next question – it is nice to know that this is Melanoleuca angelesiana, but how does it fit within Melanoleuca? i don’t see the type sequence in Genbank and would like to know more about it!

M. angelesiana – 1bp different from type
By: Danny Miller (alpental)
2019-05-22 18:32:47 AEST (+1000)

It’s rather stocky, but it’s only 1 bp different from the type of M. angelesiana, which Matt Gordon sequenced.

Posted sequence
By: Richard Bishop (Leciman)
2017-11-13 17:49:38 AEDT (+1100)

It appears this collection is most closely related to Melanoleuca robertiana if that name is applied correctly.

Thank you!
By: else
2017-05-18 08:18:19 AEST (+1000)

thanks for getting back to the specimen and getting more information on the microscopical details. If you could sequence it locally – that is the best way to do so!

Voucher and Sequence request
By: Richard Bishop (Leciman)
2017-05-18 07:33:26 AEST (+1000)

Else,
I have posted info on spore characters and Melzer,s reaction. I do not feel competent to interpret pieleipellis structure. I could probably get Judy Roger to help me with it but would probably take about a week. Alternately we would be happy to send it to you. We do have someone locally that could sequence it for us.

voucher & sequence
By: else
2017-05-18 02:29:57 AEST (+1000)

and a thorough study of the microscopic characters (spore shape, ornamentation, reactions in Melzer’s reagent etc., presence of cystidia, structure of pieleipellis) are asked for !

Thanks Else
By: Jacob Kalichman (Pulk)
2017-05-17 10:20:26 AEST (+1000)

That proposal was overconfident.

This doesn’t look like it should be a Melanoleuca, though…

not Pseudotricholoma
By: else
2017-05-17 08:01:23 AEST (+1000)

Pseudotricholoma spores are smooth and amyloid, not ornamented, and the pileipellis is fibrillose, which this one does not have either.

Created: 2017-05-16 15:26:14 AEST (+1000)
Last modified: 2019-06-02 03:42:26 AEST (+1000)
Viewed: 256 times, last viewed: 2019-08-13 07:53:35 AEST (+1000)
Show Log