Notes:
Specimen in thumbnail;
Overall – 12.8cm
Cap – 4.7cm W
Stipe – 0.9cm W
I collected all 3 specimens if you’re interested Rod.

Images

Habitat.
Habitat.
9.5u x 7.5u

Proposed Names

28% (1)
Recognized by sight: These do not macroscopically resemble recent confirmed DNA finds of Amanita rooseveltensis
57% (1)
Recognized by sight
Based on chemical features: Partial ITS\LSU

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
The voucher material for this observation has been accessioned in our herbarium.
By: R. E. Tulloss (ret)
2018-07-15 16:23:14 CDT (-0400)

Thank you, Ryan.

Very best,

Rod

When I align one of my sp-GSM04 sequences with the short sequence I described…
By: R. E. Tulloss (ret)
2018-07-10 16:02:32 CDT (-0400)

and the sequence the sequence that Ryan posted. All the divergence is a result of hets in Ryan’s posted LSU. This is almost always because of hets that could be interpreted as in sp-GSM04 or not and the sequencing equipment interpreted the sequence in the manner that created a disagreement with the sequences I’ve posted on GenBank. Again, I think that this is a quality problem. To convert all the hets to the second possible read (always the weaker signal) seems a gratuitous choice. My conclusion is that the species could justifiably be ID’d as sp-GSM04, but the sequence should be restrained to a length of 200 characters as follows:

AGGATTCCCCTAGTAACTGCGAGTGAACCGGGAAAAGCTCAAATTTGAAATCTGGCAGTCTCTCTTTTCTTCTTTGGCTGCCCGAGTTGTAATCTAGAGAAGTGCTTACCCGTGCTGGACCATGTATAAGTCTCCTGGAATGGAGCGTCGTAGAGGGTGAGAATCCCGTCTTTGACATGGACTTGCCAGTGCATAGTGGK

This manages to include only one het and is long enough to be submitted to GenBank.

Restricting oneself to the best quality signal in your read of the ITS,…
By: R. E. Tulloss (ret)
2018-07-10 15:25:28 CDT (-0400)

there are thirteen characters from the end of 18S (SSU) and 80 characters from the beginning of ITS. If the 93 characters are BLASTED against GenBank, there are several matches involving all 93 characters and a passably good match. Among the best results are those with 97.8% similarity: Amanita sp-GSM04, and something from Korea misidentified with the name of a species of section Lepidella (A. alboflavescens). I disgregarded the latter. I don’t think that this information is sufficient to decide that the ITS fragment “identifies” the specimen as sp-GSM04.

I then reviewed the LSU sequence information. For this purpose I took the best quality continuous sequence that I could find (194 characters) and BLASTed this against GB. This yielded 100% coverage with 100% similarity for this sequence:

“Amanita sp. ‘sp-GSM04’ voucher RET 375-9 28S ribosomal RNA gene, partial sequence”

RET 375-9 is one of the two original collections used to characterize the species with the temporary code Amanita sp-GSM04. Hence, at the present time, the LSU sequence is reasonably good evidence that this observation concerns material of sp-GSM04.

Yes, I would be interested.
By: R. E. Tulloss (ret)
2017-07-10 23:49:28 CDT (-0400)

Thank you for asking.

Very best,

Rod

Spore dimensions fit rooseveltensis.
By: Dave W (Dave W)
2017-07-06 22:36:08 CDT (-0400)

Caps are more uniformly dark than what I’m used to seeing. But most of my collections of this species have come from an open sunny area.

I collected some gray dark-capped grisettes today that have ellipsoid spores. Will eventually post.

Created: 2017-07-05 21:14:06 CDT (-0400)
Last modified: 2018-07-16 08:52:08 CDT (-0400)
Viewed: 160 times, last viewed: 2019-06-07 18:59:07 CDT (-0400)
Show Log