Observation 293795: Amanita sect. Amanita

Species Lists

Images

DSC00643.JPG
Amanita alpinicola trio
DSC00647.jpg
ephemeral PV and base detail
DSC00649.jpg
cap/wart detail
DSC00650.JPG
epemeral PV

Proposed Names

14% (2)
Recognized by sight: squat pale yellow capped high elevation amanita w/ephemeral PV
Used references: Rocky Mt. Mushrooms by Habitat
57% (1)
Recognized by sight: despite its macromorph similarity and growth at elevation, this is NOT alpinicola. this is one of several unnamed gemmatoid amanitas in the west.
Used references: Cathy Cripps
Based on chemical features: CTGCGGAGGNTCATTATTGAAATAAAACTCGGGCAGGGGGAGGTGGTTGTAGCTGGCNCCTAGGGGCATGTGCACACTGTCTCTCTCTTGCTTGTTTTTTTCNTTCTTTCCACTTGTGCACTGCTTGTAGGCAGCCTGGCACTGTTCAGGTTGTCTATGATTTTCTTTACATACATGAATCATTGTTGTACAGAATGTGATAAAAAAGAGTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCTCAAAACATACACTTGAGTGTGTTTTGGATTGTGGGAGTGTCTGCTGGCTTGTTTATACATGAGCCAGCTCTCCTGAAAGACATTAGCTTTGGGGGGGATGTGCCAAGTCACTTCTGCCTTTCCATTGGTGTGATAGATGAATAAACTTATCTACGCCAGGAAAGCAGGTTGCAGGTGAAAGCACTGTGATCTCTCTGCTCTCTAATTGACATTNNTNTGATAAC
CTGCGGAGGNTCATTATTGAAATAAAACTCGGGCAGGGGGAGGTGGTTGTAGCTGGCNCCTAGGGGCATGTGCACACTGTCTCTCTCTTGCTTGTTTTTTTCNTTCTTTCCACTTGTGCACTGCTTGTAGGCAGCCTGGCACTGTTCAGGTTGTCTATGATTTTCTTTACATACATGAATCATTGTTGTACAGAATGTGATAAAAAAGAGTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCTCAAAACATACACTTGAGTGTGTTTTGGATTGTGGGAGTGTCTGCTGGCTTGTTTATACATGAGCCAGCTCTCCTGAAAGACATTAGCTTTGGGGGGGATGTGCCAAGTCACTTCTGCCTTTCCATTGGTGTGATAGATGAATAAACTTATCTACGCCAGGAAAGCAGGTTGCAGGTGAAAGCACTGTGATCTCTCTGCTCTCTAATTGACATTNNTNTGATAAC

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
just for fun
By: Debbie Viess (amanitarita)
2018-06-25 14:06:41 CDT (-0400)

maybe I will check the spores on the ones that I still have, and see if they match up to Ron’s Yuba Pass example.

macro morph is not always clear.
By: Debbie Viess (amanitarita)
2018-06-25 14:05:28 CDT (-0400)

hindsight is 20/20, though!

this just popped up
By: Debbie Viess (amanitarita)
2018-06-25 11:39:08 CDT (-0400)

and reminded me that I had an MO amendment to do! Cathy Cripps ran the DNA and it turned out to NOT be alpinicola, with only a 95% match. It did show a 99% match with other collections of unnamed gemmatoid amanitas from BC.

Cathy agreed that the macromorph certainly looked like alpinicola, however!

Shows to go that you can’t always tell just by looking.

one specimen just sent to Cathy Cripps for sequencing.
By: Debbie Viess (amanitarita)
2017-11-17 19:35:41 CST (-0500)

we’ll see if this is a match for alpinicola, or yet another unnamed gemmata type!

this brand new species
By: Debbie Viess (amanitarita)
2017-10-09 15:48:25 CDT (-0400)

was just published in the July-August issue of Mycotaxon.

Created: 2017-10-09 15:43:09 CDT (-0400)
Last modified: 2018-06-25 14:06:42 CDT (-0400)
Viewed: 90 times, last viewed: 2019-12-24 18:26:03 CST (-0500)
Show Log