Observation 297804: Cyathus sect. Eucyathus

Notes:
Ecoregion: Southern Outer Piedmont
Habitat: Under hardwood in mowed field
Substrate: Wood chips
Nearest_Tree: Hardwood, Oak
Habit: Small/large clusters
Nest: Ca. 7-8 mm high and 6-7 mm wide; vase-shaped; inner surface had distinct grooves; bald; shiny metallic appearance. Outer surface of immature nests buff to dark brown; shaggy, with tufts of coarse hairs.
Eggs: 5-6/nest; elliptical to triangular; metallic gray, shiny.
Collector: Joan Knapp
Identifier: Joan Knapp
Collection_#: YRP-20171106-19

Species Lists

Images

February 25th, 2018
February 25th, 2018

Proposed Names

85% (1)
Used references: Brodie, Harold J. (1975). The Bird’s Nest Fungi. Toronto: University of Toronto Press. ISBN 0-8020-5307-6.
28% (1)
Recognized by sight

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
Danny
By: Joan Knapp (PucaK)
2018-03-12 22:56:57 CDT (-0400)

Sorry for the delay in getting back to you. I had submitted this for sequencing in our local Mycoflora project. Here is the sequence…
GAACCTGCGGAAGGATCATTATTGAATTAATAAAAGTGGGCTTTCAAGTGGTGGCTGATGCTGATGGTCAAACATATGTGCTCGCCGCCATGAGGGGTTCATTTTTTTATTAACCTTTCCACCTGTGAACTATTGTAGATGTTGCAGATCAATTCCTCAGGCAGCAATGCTTGGTTTGGAGTTTGCGGGCTTCATTCAGTTGAAGTCAGCTTTCTCTGCGATCGACAATGTCTATTTTACATATACCCTTGATTAAAGTAAAGAAGGACTTGATTGGGCTTTAATGCCTATAAATCAATAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCCACTATCTTTATTGATAGTGCGTGTTGGATGTGGGGGTTTTGCGGGCTTCATTCAGTTGAAGTCGGCTCCTCTGAAATACATTAGCGGGAATCTTTGTTGAACCGCTTCTATTGGGTGTGATAATTATCTACGCCTAGGAAGCAGTCCAGCACTTGGGTTTGGCAACAAACCGGGATTCTGCTTCTAATCGTCCTTGGACAATGACTTTGACATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAG
If you are interested in the specimen, let me know
Of course, I’d be interested in any feedback on a confirmed ID.

Joan
By: Danny Newman (myxomop)
2018-03-08 15:06:56 CST (-0500)

would you be willing to go the distance with this collection to determine if it is, truly, C. striatus? There are many striate, externally hairy Cyathus spp., grouped by “Nidulariologist” extraordinaire, Harold Brodie, into a section he called Cyathus sect. Eucyathus. the diversity is greater the further into the American tropics you go, but I am confident that more than one species occurs even as far north as Georgia. see my species list for more info.

Created: 2017-11-09 12:30:01 CST (-0500)
Last modified: 2018-04-22 16:20:25 CDT (-0400)
Viewed: 154 times, last viewed: 2019-09-21 04:46:01 CDT (-0400)
Show Log