Notes:
Ecoregion: Southern Outer Piedmont
Habitat: Growing in soil in leaf litter at edge of trail
Substrate: Soil
Nearest_Tree: Hardwood, oak
Habit: Few
Cap/upper_surface: Largest ca. 3-4 cm diameter; flat or with margin curled up; slimy; bald; yellow when young, becoming orange to red with age.
Cap/underside: Gills attached or attached by notch; distant; margins ragged; some evidence of cross-veining
Stipe: Ca. 4-5 cm long and 0.5-1 cm diameter; equal along length; dry; bald; yellow. One stipe appears as a double stipe on one side, but as a single stipe on the other side.
Odor: No distinctive odor
Spore_Print: White
Spores: Ellipsoid; smooth
Collector: Joan Knapp
Collection_#: FYA-20171207-02

Species Lists

Images

Stipe appears to be two stipes on one side, but a single stipe on the other side. No evidence for two caps

Proposed Names

12% (2)
Recognized by sight: said to have dry stipe vs. H. chlorophana but may be a synonym—flattened cadmium orange cap, adnexed yellow gills, stipe often compressed or grooved on one side, mixed woods
66% (2)
Recognized by sight
83% (1)
Used references: See Jean Lodge’s comment below.

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
Sequence
By: Joan Knapp (PucaK)
2018-10-18 13:56:05 PDT (-0700)

The sequence wasn’t long enough to be particularly useful

Great observation Joan
By: Terri Clements/Donna Fulton (pinonbistro)
2018-10-17 07:41:03 PDT (-0700)
Hopefully you can post the herbarium record number and ITS sequence at some point as recommended by the NAMP.
Hygrocybe chlorophana by appearance and ITS sequence
By: D Jean Lodge (djlodge)
2018-10-17 03:33:45 PDT (-0700)

The top two photos are consistent with H. chlorophana – golden colored & viscid. I’m uncertain of the lower two photos. The ITS sequence matches verified collections of Hygrocybe chlorophana.
I corrected the consensus sequence and obtained 681 readable bp (pasted below) of which only 8 were exclusive substitutions or single bp indels (1.1% difference) from a sequence of H. chlorophana from Tennessee (GenBank FJ596922 collection DJL06TN16) and 19 hard bp (2.8%) divergence from Kew H. chlorophana (mis-identified as H. flavescens, which doesn’t occur in Europe, GenBank EU784301)

GAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACTGAAGCAAATTGGGAAAAGGGATGTTGCTGGCCTCCCTCGGGAGGCAGCATGCACTCCCTTTCCCCTTAAGCATTCACATAATAATTTCCYTCACACMAAACCGTGCACTTACCTGTAGGGAAATCTCAGAGGCATYTTCGGGTCCTCTTGGCTTCCCTATGTCATTTCATGTCACMCGAGTTCTYTGAGAATGTATCTGTCAAAGRAAAAGTAATCACAGAACAACTTTCAACAACGGATCTYTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATTGAATCTTTGAACGCCTCTTGCGCCTCTTGGTATTCCGAGGGGCMTGCCTGTTTGAGTGTCATTAGAACTATCAAAAAACAATGGTTTCGATCATTATTTTTTGGAATTGGAGGTGGTGCCCTGGGTCTTTTGAGAAAAAAGACTCCCCGAGCTCCTCTGAAATGCATTAGCGAAATGCAGTGCACTTTCTTCYCCTTGGGGCATTGATAGTTACTTTCATGTCCTAAGCTGCGGGGAGGAAGTCACAGAATGCTTTCTTGCTCCTGAACGTGTAAATCTTGACAATCAAAGCCCTCAAATCAGGCAGGACTACCCGCTGAACTTAAGCATAT

In contrast there were 66 ‘hard’ substitutions and indels out of 706 bp (9.3% divergence) when compared to the consensus of two H. flavescens sequences from Tennessee (DJL06TN25 seq. by K. Hughes and SC-19 seq. by Rizzo)

Created: 2017-12-08 19:21:59 PST (-0800)
Last modified: 2018-10-26 06:38:51 PDT (-0700)
Viewed: 120 times, last viewed: 2019-11-23 20:37:00 PST (-0800)
Show Log