Notes:
Collected and photographed by Sidnee Obersingleton. “The location was at roughly 500’, outside of Eugene OR behind Lane Community College. The forest was mostly Doug fir with some oak and bigleaf maple, this branch was unidentified but my gut tells me it is oak. Old enough to be coated in mosses and plants, the log was pretty well decayed.”

Sent for sequencing via Oregon Mycological Society. Results are included in comments below.

Species Lists

Images

1.jpg
2.jpg
3.jpg

Proposed Names

56% (1)
Recognized by sight
55% (1)
Based on chemical features: See Comment “Similar sequences” below.

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
If
By: Chaelthomas (Chaelthomas)
2018-11-26 17:31:49 PST (-0800)

at all possible, I can try to obtain a specimen from Finland to compare with.

Similar sequences
By: Joseph D. Cohen (Joe Cohen)
2018-07-13 07:03:22 PDT (-0700)

Thanks so much for posting the comment with the sequence data. I’ve also added the sequence as an MO Sequence.

1 Dai, YC., Xue, HJ., Vlasák, J. et al. Phylogeny and global diversity of Polyporus group Melanopus (Polyporales, Basidiomycota) Fungal Diversity (2014) 64: 133. https://doi.org/10.1007/s13225-013-0248-3.

Sequence comment
By: Matt Gordon (Matt G)
2018-07-12 22:51:02 PDT (-0700)

This is 99-100% similar to 10 “Polyporus tubiformis” in GenBank, which doesn’t appear to be a valid name.

ITS sequence
By: Matt Gordon (Matt G)
2018-07-12 22:49:45 PDT (-0700)

ITS sequence for this specimen:
AGGAAGTACAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAACGAGTTTTGAAAGGGGTTGCAGCTGGCCCTCCTTGTCGGAGGCATGTGCTCGCCCTGCTCAATCCACTCTACACCTGTGAACTTACTGTGGGTCTTGGTGGGCCTTCGTCCTTCCGGGGGCGTCGGCTTTAACCTGGCCTACGTTTTATTTACAAACACTTTTAAAGTATCGAGAATGTCTACTGCGATATAACGCATTTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCACGCCTGTTTGAGTGTCGTGAAATTCTCAACCTACAAATCTTTTTTGTAGGCTTGGACTTGGAGGCTTTGCCGACGTTTTCTAATGCCGGCTCCTCTCAAATGCATTAGCTTGTGTCCTTGCGGATCGGCTCTTCGGTGTGATAATTGTCTACGCCGTGGTCGTGAAGCGTTTTTGACCGGCTTCTAATGGTCTCGTTTACGAGACAAGTATCATTTTTCAAATGACAATCTGACCTCAGATCAGG

Delivered to Molecular Solutions
By: Joseph D. Cohen (Joe Cohen)
2018-05-30 06:09:14 PDT (-0700)

Delivered to Matt Gordon, Molecular Solutions, LLC, 2018-05-29, for sequencing.

Created: 2018-05-10 22:15:49 PDT (-0700)
Last modified: 2018-11-27 14:10:10 PST (-0800)
Viewed: 109 times, last viewed: 2019-08-29 04:27:27 PDT (-0700)
Show Log