Notes:
Probably M. americana, but was wondering about M. prava.

The trees nearby are Doug fir, vine maple, and western redcedar, possibly big leaf maple. There is cottonwood in the general area, but significantly far from this morel, way down the edge of a steep cliff far below, closer to the river’s edge (this was at the top of the cliff, set back from the path about 20 ft). I have found other blonde morels in similar areas in Oregon where cottonwood was not anywhere significantly close by, causing me to wonder if they are associating with some other trees.

Images

IMG_9293.JPG
IMG_9294.JPG

Proposed Names

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
I made a tree
By: Alan Rockefeller (Alan Rockefeller)
2018-07-18 23:25:30 CDT (-0500)

And Matt is right, Morchella americana falls out in the exact same clade as Morchella esculenta. Other genes are needed to tell them apart. Due to the location, this is M. americana.

However there are 5 bases different between this and the holotype of M. americana, whether that’s significant or not who knows, probably not. But some species are delimited by much less, like 1 or 0 ITS bases.

These long sequences don’t BLAST very well, it helps to just blast the ITS part and leave the LSU off to get more results. Otherwise the low query coverage pushes them off the page. You can also ask for 500 or 1000 results rather than just 100, that way the well matching but not completely overlapping sequences are in there.

A few selected comparisons
By: Joseph D. Cohen (Joe Cohen)
2018-07-18 22:27:26 CDT (-0500)

What a mess. Perhaps many of default BLAST hits have simply been misnamed.

Here are some selective comparisons.
This Observation is a:

  • 99% match (73% Query Cover) to the M. americana holotype, KM587992 (This is missing from in the default BLAST results because the holotype sequence is so short).

I also looked at few of the sequences of M. americana in the Richard1 phylogenetic tree, and see

I don’t have time to look at Richard’s other M. americana sequences. And I don’t have time to look at his M. esculenta sequences. That would be an interesting exercise if anyone is interested; it might confirm/refute the usefullness/uselessness of ITS to differentiate these two species.

Finally, I note that Richard says that M. esculenta is a European species. (Based on that and the molecular evidence, I voted for M. americana.)


1 Franck Richard, Jean-Michel Bellanger, Philippe Clowez, Karen Hansen, Kerry O’Donnell, Alexander Urban, Mathieu Sauve, Régis Courtecuisse, and Pierre-Arthur Moreau, “True morels (Morchella, Pezizales) of Europe and North America: evolutionary relationships inferred from multilocus data and a unified taxonomy”, Mycologia 2015; 107:359-382 doi:10.3852/14-166 http://www.mycologia.org/content/107/2/359

Sequence comment
By: Matt Gordon (Matt G)
2018-07-13 01:06:53 CDT (-0500)

Not at all similar to M. prava sequences. Close to M. esculenta and M. americana. in GenBank, the ITS sequences for these 2 species do not sort out into distinct groups, so at this time, ITS is not useful for distinguishing them.

ITS sequence
By: Matt Gordon (Matt G)
2018-07-13 01:04:32 CDT (-0500)

GACAGTGGGGAGAGAGGCACCAGCGATGGAGGACGCCGCCACATTGGCGGGTTCCGTACCCCAGTGTTGGTCCAGGGCGGGCCAGCTGCGACGGTCTCATCCGCATTCCCTGCGTTTTGGCAGCAAGCCCCGAATCGGGGTGGGAACGGATCGTGCAATCAATGCTCTGCAGCCATCCATACGGGTTGGGTGAGCGCGCAGAGTAGACTATTGCTGCGCTAAAGGAGACCCGTCGCGGCAGGTGGCGGACGGCACATGCAGGACTGATCCCAACCATGTGTTGATTCCCCTGGGGCCGGGGTTGTAGAATACCCCGGCGACTCGCAGACGGCGTGTACCCTCGTTTGGCCCCCTCTCGCCATTGTCCCAACCAAAACCCTCTGTGTACCCCTTCCCTGTTGCTTCCCCCGGGGCACTGGCTCCGGCCAGCCGGGGGGAGAAACCAAGCAAAAACCCTTTTTCGCAAAAACAGACGTCTGAACATCAAAAACAAAAAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCCACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTCGAGCGTCATAAATACCCCTCCTCCTCGGATTGCTTTTGCGGTCCCTGGGGGGTTCTGGCAATGTGGATTCCCCGTGCTTTGAGGGCATGCGGACGGGCTCCCAGTGCTGAAAGACATAATGTTCCCGGCCGAAACCGGTGATTAATTTCACTGGCGGGATTCGTGGCAGGTAGACTGAGGGCGTCAACCGTGGAGTCATGAGGGTAGAAACCTCCCCCTTTGCAAGTAACATTGCTCTGGCAGTTAGATCTGCAGGCCCGACGGTCTGGGGATGGACCTCCCACTCGCAGGCGTCACGGCCACGATAGCGGGCGTTAAACGGAATCCGATCCGCCTTCACGGGTGGTTGAAGATCCTTGTGGGCTAGCA

Delivered to Molecular Solutions
By: Joseph D. Cohen (Joe Cohen)
2018-05-30 07:58:41 CDT (-0500)

Delivered to Matt Gordon, Molecular Solutions, LLC, 2018-05-29, for sequencing.

Created: 2018-05-16 23:43:27 CDT (-0500)
Last modified: 2019-05-13 19:11:14 CDT (-0500)
Viewed: 100 times, last viewed: 2019-08-23 04:19:38 CDT (-0500)
Show Log