Observation 316815: Cerioporus Quél.

Notes:
Collection_#: OMS 300499
Collector: Joseph D. Cohen (Joe Cohen)
Identifier: Joseph D. Cohen (Joe Cohen)
Habitat: mixed conifer/hardwood forest
Substrate: wood, probably Alnus (Alder)
Habit: few
Taste: indistinct
Odor: morchelloid
Other: Pores — density: ~ 9/mm; size: ~ .12mm (see photo of pores)
Darkens slightly tanner with age (compare in situ photo with day-old photo)

Species Lists

Images

IMG_4988.jpg
IMG_4986.jpg
IMG_4987.jpg
IMG_4993.jpg
one day old
MO 316815 OMS 300499 pores.jpg
pores
MO 316815 OMS 300499 100x.jpg

Proposed Names

60% (2)
Recognized by sight
61% (2)
Recognized by sight: Gross morphology is somewhat close to the eastern C. squamosus
29% (1)
Recognized by sight: Suggested by Jim Ginns (based on a description I sent him). He adds:
“The name Polyporus ciliatus is rarely used in North America. Probably because the group (Polyporellus) has not been subject to a detailed study. Identifying North American specimens as P. ciliatus may stir-up some interesting discussion.
The best treatment of P. ciliatus is in Ryvarden and Melo, 2017, Poroid fungi of Europe, second edition, Synopsis Fungorum 37, pages 334-335.”

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
Hey Matt
By: Chaelthomas (Chaelthomas)
2018-07-13 02:00:02 CDT (-0400)

You can send it to my email “chowmetal@hotmail.com”

I sent you a message on my other email involving Wildcat Mtn. Not sure if you got it.

Sequence comment
By: Matt Gordon (Matt G)
2018-07-13 01:46:40 CDT (-0400)

In GenBank, this is 97% similar to 23 “Polyporus varius”, which is now apparently synonymous with both Cerioporus varius and Polyporus picipes. MO 316815 is close to these specimens labeled as “P. varius”, but appears to fall outside of the normal ITS variation seen in this group. I would like to show a phylogenetic tree at this point, but cannot paste a jpg file here.

ITS sequence
By: Matt Gordon (Matt G)
2018-07-13 01:37:49 CDT (-0400)

ITS sequence of this specimen:
CTTTTACCGGGCAAGTGCTCGCCCTTTCGAATCCACTCTCTACACCTGTGCACTTACTGTGGGTCTTGGTTTTGTTCACTCTCTTGTGTGATCTTAATTGATCTTACGGGGGAGGGGGGGAACTGGGCTCGCATTTTATCACAAACCCCTTCAGTATCAGAATGTTTATTGCGATATAACGCATTTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCACGCCTGTTTGAGTGTCATGAAATTCTCAACCTACAAACACTTTGTGTTTTTTGCTAGGCTTGGACTTGGAGGTGTTGCGGGCTCGATTTAGAGTCGGCTCCTCTTAAATGCATTAGCTTGATTCCTTTGTGGATCGGCTCTCGGTGATAATTGTCTACTCCGTGACCGTGAAGCGCTCGGCAAGCTTATCAATTTGTC

Collection location, Polyporus s.l., confidence level, sequencing
By: Joseph D. Cohen (Joe Cohen)
2018-05-30 08:52:27 CDT (-0400)

Collection Location is accurate. (It was automatically imported from the photo EXIF data.)
Re “Polyporus”. I modified the MO Name Polyporus sensu lato so that it could be used for your purposes. This will make your intent transparent, and also will allow everyone to differentiate between Polyporus sensu lato and Polyporus sensu stricto P. Micheli ex Adans..
Re confidence level. When voting on a Proposed Name above the rank of species, consider using a less extreme confidence level. This will make it easier for the Site ID to evolve to a more specific rank.
Re Sequencing: As noted, I already gave this collection to Molecular Solutions which has been the primary sequencing provider for the OMS Mycoflora Project. It’s great that you’re getting your own equipment. I look forward to seeing your results.

Delivered for sequencing
By: Joseph D. Cohen (Joe Cohen)
2018-05-30 07:59:31 CDT (-0400)

Delivered to Matt Gordon, Molecular Solutions, LLC, 2018-05-29, for sequencing.

I was just asking about
By: Chaelthomas (Chaelthomas)
2018-05-29 21:44:40 CDT (-0400)

If it was picked near Mt. Rainer.
As for Polyporus, I am using it in the general sense of identification. There are still many mushroom species in that genus that need to be worked out and need to be moved in or out of it. The blackless stipe may just be an environmental thing and it May very well just be C. Varius. If you have a sample to spare I’d love to hold on to it for DNA sequencing. My PCR unit will arrive soon within the next few days and Alan is helping me with it.

Polyporus vs Polyporaceae
By: Joseph D. Cohen (Joe Cohen)
2018-05-29 11:00:29 CDT (-0400)

It’s highly probably that this will turn out to be some in, or recently moved from, Polyporus. It looks, and measures, like Cerioporus varius (Polyporus varius), except that it has zero black on the stipe. Compare to descriptions and photos of Polyporus varius in Gibson, Matchmaker: Mushrooms of the Pacific Northwest, Version 2.2.1 (2015) (application, latest version downloadable at http://www.svims.ca/council/matchmaker.htm).
I therefore have deleted my proposed name of Polyporales. I am retaining Polyporaceae because it’s unclear whether this will be in Polyporus ss or another genus, e.g., Cerioporus.

Could you clarify your question?
By: Joseph D. Cohen (Joe Cohen)
2018-05-27 18:58:16 CDT (-0400)

I don’t understand what you’re asking by: “Mt. Rainier ???”

Mt Rainer
By: Chaelthomas (Chaelthomas)
2018-05-27 01:17:48 CDT (-0400)

???

microscopy failure
By: Joseph D. Cohen (Joe Cohen)
2018-05-26 20:58:50 CDT (-0400)

I tried scoping this specimen. But my technique is such that I can’t see more than a thick mat of undifferentiated hyphae. See image 873731. I don’t want to destroy more of this small specimen, so I won’t try again.

Created: 2018-05-20 19:49:50 CDT (-0400)
Last modified: 2018-07-14 18:10:07 CDT (-0400)
Viewed: 198 times, last viewed: 2019-08-23 06:08:39 CDT (-0400)
Show Log