Notes:
Striking red color.
Only trees near were vine maple – near small slow moving stream.
Several stipes – with no cap. My guess is eaten by a critter. A bird?
Mycoflora Project number – 09484
TAGGTGACCTGCGGAAGGATCATTAATGAATAAACTTTGAGGATGTTGCTGGCTTTGTCTTTTGGGATGAGGCAGGTGCACTCCTCGGATATTCTTTTGACCACCTTTCACAAACCATGTGCACCCTCTGTAGGTCTGGCCTTTTGTTCCAAACCTATGTTTTAGCCATCTGCTCCATGGAATGTCATTTGAATGTTGAATCTTCTTTGATAATACACAACTTTCAACAATGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCTGAGGGGCATGCCTGTTTGAGTGTCATTGTAATCTCTCAACTTTGGTCTTTGGTTTCTTAACCCAAGGCCCAGAGTTTGGATGGTGGAGGTGTGCTGGCCGCCCCCCGTGGAGGGGTCAGCTCCTCTGAAAAGAATCAGCAAAGGGAAACGTACCTGTTCCTGCATCTCGTGCTTCTGGCATTGATAATYGTCTATGCCTGTTGTGGCTCAGATGCCTTTTGGATCGGGCGAGTGTCTTTGCTTACAGTTGTCCTTTGGACATTTTGACAAATCACCTCAAATC

Images

Hygrocybe cantharellus (09484) - 10.jpg
Hygrocybe cantharellus (09484) - 11.jpg
Hygrocybe cantharellus (09484) - 14.jpg

Proposed Names

84% (1)
Used references: Hesler and Smith

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
west coast Hygrocybe cantharellus
By: Steve (Lokness)
2019-04-14 14:34:38 MDT (-0600)

There are 20 sequences that show up in GenBank for H. cantharellus. Two are from the west coast, an old short read I put in two years ago and one put in in 1998 from California. Doing a Blast on the one from 1998 produces no matches with this group – it is misindentified. My short read from 2017 matches closely with a bunch of H. cantharellus.

Suggesting that the H. cantharellus is in the PNW but not from California!

This observation is meant to support the short read from 2017.

Danny; Hygrocybe cantharellus
By: Steve (Lokness)
2019-04-14 12:42:21 MDT (-0600)

This is actually a pretty interesting find. So we have H. cantharellus in the PNW – but it seems to be missing from California. Check out the occurrence map for this species. One of the most fascinating occurrence maps I have seen. A new tool!

H. cantharellus
By: Danny Miller (alpental)
2019-04-13 23:03:04 MDT (-0600)

This sequence is a 99% match to one of the reference sequences in the H. cantharellus complex used in the 2013 Lodge paper, even though UNITE has several competing concepts for it. So it seems to be in that complex. H. turunda also seems to be closely related.

It’s also a 99% match to 320749