Please do not re-click a link while waiting for a page to load. (It’s slower and degrades site speed for all users.)
To get images for machine learning, see MO Images for Machine Learning

 

Notes:
Found by Jen Chandler
In full sun all day in grass
Might be H. miniata but just looks a bit different.
Intense red throughout; cap, gills and stem
sequence from MP;
TAGGTGAACCTGCGGAAGGATCATTACTGAAAAAATATTTGAGGATGTTGCTGGCATTTGCACGTGCACTCCTTGAACCATTTCTGACCCTTTTCACACCATGTGCACCTGTTGTAGGTTTTTTTGGTTTCACAACCAAAACCTATGTTTGCTCTTTTTAATAACACCATTGAATGTATCTGAATGCAYGGTTGGACAAAAAGGGCCCTCCGGCTCTGGATGTCAAAAATAAAACACAACTTTCAACAATGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATTGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGRGGCATGCCTGTTTGAGTGTTATTGAACCCCTCTCAACCCTTGGCCCTTGAGCGGTCGAGGTTTGGATTTGGAGAGTGCCGGCCAAGTTTGGCTCCTCTAAAATGCATTAGCGAGCGATGCTTTCATGCGACTGCTTTGGCATTGATAGACCTGTCTATGCCTAGGTGCCGCTGGCGGGTTTGCTTACGAGCGGTCCCCTTTGGGGGACAAATGCAAC

Images

H. Miniata or Ceracea, sized.JPG
H. Miniata or Ceracea in Grass.JPG
Notice black center – typical of Hygrocybe phaeococcinea
Hygrocybe miniata or ceracea - 08119.jpg

Proposed Names

63% (2)
Used references: Waxcap Mushrooms of Eastern North America
21% (3)
Based on chemical features: Based on new sequence information
84% (1)
Used references: only 95% similar to EU784336 Hygrocybe phaeococcinea which is the UNITE reference sequence. The taxon was described from the Netherlands. Subject is likely the same as MN202583 H. cf. phaeococcinea.

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
Terri; long history on this one
By: Steve (Lokness)
2021-06-10 17:39:07 MDT (-0600)

Eric who found it in Washington State (well Jen his wife found it) where it was the first to be sequenced from NA – wanted to give it new species status.
Jean Lodge the real expert with this group looked at it and didn’t agree. She believes it to be a single species even with the DNA variance you noted. Jean did a lot of work on this guy and did a paper through MP (now FunDiS). The paper took on the question; what is a new species. I think it is still posted on the FunDiS site.
Finally after three years Eric found a second population of these in Washington State which SSMC sequenced – the sequence matched this guy. He has not relocated the initial observation so this second strong showing has been very helpful.
Can we make claims of other variables that might point to species status? Perhaps. Eric is working hard on that even as he struggles to get a sequence from Type mushroom from the Netherlands.
It has the friendly name of Devils Stool and shirts will be available soon!

Suggested Common Name: Devil’s Stool
By: ERIC & JENNIFER S CHANDLER (EJChandler)
2019-09-01 12:56:43 MDT (-0600)

As in a single-legged Bar Stool. Devil’s Stool because of the DEVILISH COLOR throughout the specimen.

Recent DNA analysis finds the WA State specimen is a 99.49% match to the Newfoundland specimen provided by Andrus Voitk. Further DNA study is in the works for specimens that are representative of other Canadian provinces, graciously provided by Renee Lebeuf of Quebec Canada. Stay Tuned!

!! ? New Species ? !!
By: ERIC & JENNIFER S CHANDLER (EJChandler)
2019-04-09 10:20:01 MDT (-0600)

We are both very excited about this result. We had the feeling this find was unique, but never, ever thought it would go this far.

Thank you Steve for all your hard work to nail this little baby down….we owe you!!

Eric & Jen Chandler

Hygrocybe phaeococcinea
By: Steve (Lokness)
2019-04-09 08:18:40 MDT (-0600)

Pretty interesting sequence huh. You can see from my comments that we had trouble with this one from the start but I sure never expected this result. Boertmann say it is “rare to very rare” even in Europe.
I do not disagree with any of your conclusions but given the rarity of it I hate to see it end up in the “Hygrocybe” basket. Who will ever find it there on MO? Besides, the match to the Kew sequences while outside of the usual ‘different species’ thoughts – they are just barely enough different to maybe suggest individual species status. Like so many of these on the west coast – this whole group has some serious mutation going on on this gene. They have been separated for a while by distance so that makes sense.
One more point as to why I put it where I did is that morphologically it looks like H. phaeococcinea. Check out the center picture on MO – notice the black spots in the center of the cap – exactly as Boertmann discribes the species!

Sequence looks far enough away
By: Alan Rockefeller (Alan Rockefeller)
2019-04-09 00:54:38 MDT (-0600)

The sequence looks different enough from H. phaeococcinea that I think this is unambiguously a different species. The differences look real, not the result of a dirty sequence since there are differences in ITS1 and ITS2, but not 5.8S.

Definitely put this one into Genbank so the knowledge on which Hygrocybe species are found on the West Coast can be located in future BLAST searches. I would put it in as Hygrocybe cf. phaeococcinea.

Confirmed Find & Potential Identification
By: ERIC & JENNIFER S CHANDLER (EJChandler)
2018-09-18 23:49:36 MDT (-0600)

Specimen is available and is going in for DNA assessment for the North America Mycoflora Project.

Of particular note is that the specimens were near the center of a large lawn North of the Industrial Trades Training Complex for Clover Park Technical College in Lakewood, WA. They were therefore exposed to full sun for nearly all day-light hours.

We are in agreement with Steve that it might turn out to be a different species, mainly because all of the specimens retained their intense red color even after they dried….according to most references, H. miniata loses the intensity of the red after drying.