Notes:
Collector’s_Name: Julie Jones
Substrate: leaf litter
Habitat: ravine

Species Lists

Images

Proposed Names

23% (3)
Recognized by sight
79% (3)
Used references: DNA match to type location

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
dried specimen didn’t survive
By: Julie Jones (foobear)
2019-04-27 11:28:41 CDT (-0500)

I’m sorry to say, herbarium sample is no good

=(

I will try again this year at the same spot I found these

UDB000901 is the key!
By: Danny Miller (alpental)
2019-04-09 11:33:14 CDT (-0500)

OK, bear with me here. Bart Buyck uses R. nigricans from the type locality in Sweden, UDB000901, as the most likely example of the true R. nigricans, absent a type. Here’s why. It has 6 secondary characters where its alleles differ. (sequence at the bottom).

UNITE has an overwhelming consensus of what the true R. nigricans from the EU is, including, for example, HM146856. This has only primary characters, so the 6 differences from UDB000901 are not really differences. UDB000901 is an exact match to many specimens in the overwhelming consensus like this one.

Now look at EU specimen EF126733. It has the 6 differences that don’t count, plus an INDEL, a deleted A, early in the sequence, which may not even matter since it’s so early in the sequence. EF126733 is clearly also the true R. nigricans.

Now let’s do what you did, blast this sequence against EF126733. It has 4 real actual differences, plus one INDEL. As you say, looks like our PNW R. nigricans is a different species.

But wait…

Now, finally, blast this PNW sequence against UDB000901. It only differs by 6 secondary characters that don’t count, plus two INDELS, one of which is the same questionable INDEL that EF126733 has. This PNW sequence only differs by one true INDEL from trusted EU R. nigricans EF126733, but if you blast it directly against EF126733, it looks like it has 5 differences.

It’s very interesting, and tells us that differences in DNA may not be differences if one sequence happened to amplify mostly one allele and another sequence happened to amplify mostly the other. You’ll never know until you get lucky and find a sequence that amplifies them both that you can compare them to. When you find something like that, like UDB000901, you use it as your reference sequence. Maybe there is none, but if you look at enough sequences, you can artificially construct a sequence by hand editing it that contains all of the secondary characters spotted in that species to make a good reference sequence.

Maybe if I looked harder I could find an EU specimen with that same INDEL difference and show that the PNW specimen is actually an exact match to EU material, sans secondary characters.

>R. nigricans SWE (type loc) UDB000901 Bart
GAATAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACTACAGAGGTGCGAGGGCTGTCGCTGACCTTTT TCAAAGGTCGTGCACGCCCGAGCGCTCTCGCCYAMAATCCACCTCACCACTTGTGCATCACCGCGCGGGGCCTCCCTCTTGGCTCGCTTC GAGAGAGGCTCGCGTTCTTCACATCACACACACACCTTTTTAGTTTTGAATGTCATTCATTTGCGATAACRCGCAATCAATACAACTTTC AACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAAT CTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATTCTCAAACCTTCTTGGTTYCTTGACCA AGATGGCTTTGGACTTTGGAGGCGTTGTGCTGGCTTTGCAAAAAGTCGGCTCCTCTTAAATGCATTAGTGGGGTCCCCTTTGCCAATCCC CAGGCGTGATAAGATGTTTCTACGTCTTGGGATTTGCTCTGTTCACTGGGAACCYGCTTCCAACCGTCTCGTGAGAGACATCGTTCGAGC TTGCTCGGCRCACGAATCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAAGCATA

I notice that all of the best matches are from the PNW
By: Alan Rockefeller (Alan Rockefeller)
2019-04-09 03:58:57 CDT (-0500)

However if you scroll down a bit you can see some matches from Italy and Europe that are 3 bases different. This means that it’s not just dirty sequences, but this sequence does match the US sequences better.

If no morphological differences can be seen between this and the European species, I’d call this R. nigiricans sensu stricto. If morphological differences can be seen, I think a consistent 3 base difference is enough to separate the species.

match to EU R. nigricans
By: Danny Miller (alpental)
2019-04-06 17:32:30 CST (-0600)

The DNA from the mycoflora project is a near perfect match to Russula nigricans collected from the EU, I have found DNA matches for this species often in the PNW.

Created: 2018-10-26 22:16:32 CDT (-0500)
Last modified: 2019-04-27 11:28:42 CDT (-0500)
Viewed: 73 times, last viewed: 2019-05-23 23:52:41 CDT (-0500)
Show Log