Please do not re-click a link while waiting for a page to load. (It’s slower and degrades site speed for all users.)
To get images for machine learning, see MO Images for Machine Learning

 

Notes:
On rotting hardwood

Images

Proposed Names

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
Your sequence
By: sigridjakob (sigridjakob)
2021-07-31 15:02:08 +04 (+0400)

There is a lot of NNNNs in there. Do you have the .ab1 file?

I acutally have an old low quality sequence run of trichoderma from the same park
By: PinkNightmares
2021-07-31 06:25:03 +04 (+0400)

>Podostroma_ITS1F_FASTA
NNNNNNNNNNTCGNTGGTGACAGCGGAGGGANCATTACCGAGTTTACAACTCCCAAACCCCAATGTGAACGCTACCAAAC
CGTTGCCTCGGCGGGATCTCCCTGCCCCGGGCGCGTCGCAGCCCCGGGCCAGGGCGCCCGCCGGAGGACCAACCCCCCAA
AACTCCTGTGTACATCCCGTCGCGGATTCTTACCTCTGAGCTCTCTCGGCGNCCTTAGCGGGCGTCNCTAAAATGAATCT
AACCTTTCANCAACGGATCTCTTGGTTCTGGCATCNATGANGAACTCAGCGAAATGCGACCGTANTGNNAATTGCNNACT
TTCCNCAACNNCTGNCTCTTTGAANNNGCTTTTGCTCGCTAGGCTGCGGNCTGCCNNNTCNGNNNNNNNNATATCGGCTC
NNCNGGCCTCNCCNGAGTGGGNGGATTACTCTNNANNCCACTATCANNGGNNANAACCAATAGGNCNAAACCCAANTCCG
NCNTNTTNCTGGTGNCGTTNCNTCGCTCCNNNCNCCTGANNANATNNTNCCAAACANCNCTCANNTNAATTCTCGNANAC
NTCNGGACGATANNTNCCCATGGTTTCNCCNNGNNNGCTACNNNAGCGCTCTCCTGACCNATCCTGCCATTACGGATACC
TGTCCNATNTCTCCCATTCANGCAAGAGTGACGCTTTCTCATATCTCACGCTGNGGACTCTCGATTTCCANGCAAGTNCG
TCCNNNNTGCTGGCCTTNTGTCCNCGATCCCCCCCGNNNANNCCNANNGTTGNCCTTNTNNGNAACTANNNNCCNNTANN
NCAACCNGATTAANCNCAGACCTNATCTCTCCATNNAGCTGGCGANNGNNNNNNGT